Stem-loop sequence sme-mir-277d

AccessionMI0005183 (change log)
DescriptionSchmidtea mediterranea miR-277d stem-loop
Literature search

1 open access papers mention sme-mir-277d
(2 sentences)

Stem-loop
        ucaaaaa g        --uu        u   uaa 
5' aagca       u uugguuag    gugcauuu cau   a
   |||||       | ||||||||    |||||||| |||    
3' uucgu       a aaccgguc    uacguaaa gua   u
        -ugauaa g        uauu        u   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig520: 103909-103989 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-277d
sme-mir-277dContig520: 103909-103989 [+]
sme-mir-277cContig520: 104019-104106 [+]
Database links

Mature sequence sme-miR-277d-5p

Accession MIMAT0012128
Sequence

14 - 

guugguuaguugugcauuuuc

 - 34

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-277d-3p

Accession MIMAT0004024
Previous IDssme-miR-277d
Sequence

48 - 

uaaaugcauuuaucuggccaag

 - 69

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).