Stem-loop sequence sme-mir-754a

AccessionMI0005180 (change log)
Previous IDssme-mir-754
DescriptionSchmidtea mediterranea miR-754a stem-loop
Gene family MIPF0000749; mir-754
Stem-loop
   a  -  --gc             u  uu        u 
5'  cc ca    auguugcuugggg ua  acuauauu a
    || ||    ||||||||||||| ||  ||||||||  
3'  gg gu    uauaacgaacuuc au  ugauauaa u
   a  u  agac             u  uu        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig34301: 290-362 [+]
intergenic
Database links

Mature sequence sme-miR-754a

Accession MIMAT0004021
Previous IDssme-miR-754
Sequence

10 - 

guugcuugggguuauuacua

 - 29

Get sequence
Evidence experimental; cloned [1], Illumina [2-3], 454 [3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
3
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).