Stem-loop sequence sme-mir-752

AccessionMI0005178 (change log)
DescriptionSchmidtea mediterranea miR-752 stem-loop
Stem-loop
   a      -au  -   -    a   ga     u    a -         a    aguu 
5'  uugauu   ag uua ucua uuu  aaacc ccaa g ugauuguga uaaa    u
    ||||||   || ||| |||| |||  ||||| |||| | ||||||||| ||||    u
3'  agcuaa   uc agu agau gaa  uuugg gguu c acugacacu auuu    a
   a      cau  u   g    -   ag     u    a g         a    aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1374: 32325-32438 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-752
sme-mir-71bContig1374: 32561-32660 [-]
sme-mir-2dContig1374: 32443-32550 [-]
sme-mir-752Contig1374: 32325-32438 [-]
sme-mir-13Contig1374: 32236-32295 [-]
Database links

Mature sequence sme-miR-752-5p

Accession MIMAT0012125
Sequence

27 - 

accuccaaagugauugugaau

 - 47

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-752-3p

Accession MIMAT0004019
Previous IDssme-miR-752
Sequence

71 - 

agucagcauuggugguuu

 - 88

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).