Stem-loop sequence sme-mir-748

AccessionMI0005174 (change log)
DescriptionSchmidtea mediterranea miR-748 stem-loop
Stem-loop
   caa     -uua gu            g     a    a 
5'    ucaca    u  ccuuauuauauu cuguc agua g
      |||||    |  |||||||||||| ||||| |||| c
3'    agugu    a  ggaguaauguga ggcag ucau a
   -aa     uaaa ug            a     g    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig4720: 35037-35115 [+]
intergenic
Database links

Mature sequence sme-miR-748-5p

Accession MIMAT0012123
Previous IDssme-miR-748*
Sequence

14 - 

uccuuauuauauugcugucaagu

 - 36

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence sme-miR-748-3p

Accession MIMAT0004015
Previous IDssme-miR-748
Sequence

46 - 

uggacggaaguguaaugag

 - 64

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).