Stem-loop sequence sme-mir-278

AccessionMI0005171 (change log)
DescriptionSchmidtea mediterranea miR-278 stem-loop
Literature search

1 open access papers mention sme-mir-278
(2 sentences)

Stem-loop
            cuu   c        c    uu    a  u     uucaag 
5' ggucgugau   uga uucgaaug uauu  cacc ga gcuug      u
   |||||||||   ||| |||||||| ||||  |||| || |||||      u
3' cuagcauua   auu aagcuuac auga  gugg cu cgaac      c
            ---   a        a    gg    -  -     ugacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1271: 12661-12758 [-]
intergenic
Database links

Mature sequence sme-miR-278-5p

Accession MIMAT0012121
Previous IDssme-miR-278*
Sequence

17 - 

uucgaaugcuauuuucaccagau

 - 39

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-278-3p

Accession MIMAT0004011
Previous IDssme-miR-278
Sequence

65 - 

ucggugggaguaacauucga

 - 84

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).