Stem-loop sequence sme-mir-219

AccessionMI0005167 (change log)
DescriptionSchmidtea mediterranea miR-219 stem-loop
Stem-loop
           u    c    u u    a         --caa   cuagaau 
5' cgguaauu auug ugau g ccau cgcaguucu     ggu       c
   |||||||| |||| |||| | |||| |||||||||     |||        
3' gucguuaa uaac acua c ggua gcguuaaga     ccg       g
           -    a    - u    a         auuug   uuaagca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig383: 20071-20168 [+]
intergenic
Database links

Mature sequence sme-miR-219-5p

Accession MIMAT0004006
Previous IDssme-miR-219
Sequence

15 - 

ugauuguccauacgcaguucuca

 - 37

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-219-3p

Accession MIMAT0012118
Previous IDssme-miR-219*
Sequence

65 - 

aagaauugcgaauggucauca

 - 85

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).