Stem-loop sequence sme-mir-190b

AccessionMI0005165 (change log)
DescriptionSchmidtea mediterranea miR-190b stem-loop
Stem-loop
        u   -au           u    uau     ---------   g 
5' gcacu caa   cgugauauguu gguu   uggug         agu u
   ||||| |||   ||||||||||| ||||   |||||         |||  
3' cguga guu   gugcuauguaa ccga   accac         uca a
        -   acu           u    -uu     aaucuuuag   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig258: 85956-86043 [+]
intergenic
Database links

Mature sequence sme-miR-190b-5p

Accession MIMAT0004003
Previous IDssme-miR-190b
Sequence

14 - 

ugauauguuugguuuauugguga

 - 36

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-190b-3p

Accession MIMAT0004004
Previous IDssme-miR-190b*
Sequence

56 - 

accauuagccuaauguaucgugu

 - 78

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).