Stem-loop sequence sme-mir-184

AccessionMI0005163 (change log)
DescriptionSchmidtea mediterranea miR-184 stem-loop
Literature search

1 open access papers mention sme-mir-184
(2 sentences)

Stem-loop
           uuaac     u   u         ucacauuuauua 
5' gauuuuca     uccuu gug aucuccguu            u
   ||||||||     ||||| ||| |||||||||             
3' uuaaaagu     aggaa cgu uggaggcag            a
           uuaua     u   u         gucauauuuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig15109: 7642-7731 [+]
intergenic
Database links

Mature sequence sme-miR-184-5p

Accession MIMAT0012116
Previous IDssme-miR-184*
Sequence

12 - 

acuccuuuguguaucuccguuuca

 - 35

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-184-3p

Accession MIMAT0004000
Previous IDssme-miR-184
Sequence

59 - 

gacggagguuugcuaaggaa

 - 78

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).