Stem-loop sequence sme-mir-125b

AccessionMI0005161 (change log)
DescriptionSchmidtea mediterranea miR-125b stem-loop
Literature search

2 open access papers mention sme-mir-125b
(2 sentences)

Stem-loop
   -   a   au    cau c       c     a    u a a    a 
5'  gca guu  ucga   c cugagau auaau ugcc g g uuug a
    ||| |||  ||||   | ||||||| ||||| |||| | | ||||  
3'  cgu caa  aguu   g gacucug uauua augg c c aaac c
   a   -   au    aau a       u     g    - - -    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig20519: 5873-5963 [+]
intergenic
Database links

Mature sequence sme-miR-125b-5p

Accession MIMAT0003998
Previous IDssme-miR-125b
Sequence

16 - 

ucccugagaucauaauaugccu

 - 37

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-125b-3p

Accession MIMAT0012114
Previous IDssme-miR-125b*
Sequence

56 - 

gguagauuauugucucagaguaa

 - 78

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).