Stem-loop sequence sme-mir-125a

AccessionMI0005160 (change log)
DescriptionSchmidtea mediterranea miR-125a stem-loop
Literature search

2 open access papers mention sme-mir-125a
(2 sentences)

Stem-loop
   --c   ug            uc     g    uu         uguuu 
5'    ugu  ucuguauuuaua  ccuga acca  gacugcauu     g
      |||  ||||||||||||  ||||| ||||  |||||||||     a
3'    acg  agguauaggugu  ggacu uggu  uugauguaa     g
   cuu   --            ua     a    uu         cuuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig13184: 12140-12234 [-]
intergenic
Contig3725: 34188-34282 [-]
intergenic
Database links

Mature sequence sme-miR-125a-5p

Accession MIMAT0003996
Previous IDssme-miR-125a
Sequence

19 - 

ucccugagaccauugacugcau

 - 40

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-125a-3p

Accession MIMAT0003997
Previous IDssme-miR-125a*
Sequence

58 - 

guaguuuuugguaucaggau

 - 77

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).