Stem-loop sequence sme-mir-124c-1

AccessionMI0005159 (change log)
Previous IDssme-mir-124c
DescriptionSchmidtea mediterranea miR-124c-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention sme-mir-124c-1
(6 sentences)

Stem-loop
   ug     a   uuua  a   c     u    a    u   ag 
5'   auccu uuc    cu gcg ucacc cgug ccuu guc  u
     ||||| |||    || ||| ||||| |||| |||| |||  g
3'   uagga aag    ga cgu agugg gcac ggaa cag  u
   ag     -   --ua  c   a     c    -    u   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig6861: 19831-19915 [+]
intergenic
Database links

Mature sequence sme-miR-124c-1-5p

Accession MIMAT0003994
Previous IDssme-miR-124c*;sme-miR-124c-1*
Sequence

19 - 

gcgcucaccucgugaccuuugu

 - 40

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-124c-3p

Accession MIMAT0003995
Previous IDssme-miR-124c
Sequence

52 - 

uaaggcacgcggugaaugcca

 - 72

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).