Stem-loop sequence sme-mir-124b

AccessionMI0005158 (change log)
DescriptionSchmidtea mediterranea miR-124b stem-loop
Gene family MIPF0000021; mir-124
Literature search

2 open access papers mention sme-mir-124b
(7 sentences)

Stem-loop
   guau    gaa     -        aa        u   -  a 
5'     ccau   aauuu gcauuuac  cgugucuu agu uc u
       ||||   ||||| ||||||||  |||||||| ||| ||  
3'     ggua   uuaag cguaagug  gcacggaa uca ag g
   auuu    -aa     u        gc        -   c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig12040: 20049-20132 [-]
intergenic
Contig12797: 15839-15922 [-]
intergenic
Database links

Mature sequence sme-miR-124b-5p

Accession MIMAT0012113
Previous IDssme-miR-124b*
Sequence

16 - 

ugcauuuacaacgugucuuuagu

 - 38

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-124b-3p

Accession MIMAT0003993
Previous IDssme-miR-124b
Sequence

50 - 

uaaggcacgcggugaaugcuga

 - 71

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).