Stem-loop sequence sme-mir-79

AccessionMI0005153 (change log)
DescriptionSchmidtea mediterranea miR-79 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   uuga     aa   -cuu       c  c            a  ga 
5'     aacau  ucu    cuuuggu au uggcuuugugau ga  a
       |||||  |||    ||||||| || |||||||||||| ||  a
3'     uugua  aga    gaaacca ua aucgaaaugcua cu  u
   uagg     aa   ucgu       u  a            -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2219: 55762-55854 [-]
intergenic
Database links

Mature sequence sme-miR-79-5p

Accession MIMAT0012108
Sequence

17 - 

ucuuuggucaucuggcuuuguga

 - 39

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-79-3p

Accession MIMAT0003988
Previous IDssme-miR-79
Sequence

56 - 

guaaagcuaaauuaccaaagugc

 - 78

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).