Stem-loop sequence sme-mir-71a-1

AccessionMI0005149 (change log)
DescriptionSchmidtea mediterranea miR-71a-1 stem-loop
Gene family MIPF0000278; mir-71
Literature search

2 open access papers mention sme-mir-71a-1
(2 sentences)

Stem-loop
   auuuuaaau     aa         cg           a gcu 
5'          gcaug  ugaaagaca  gguagugagau a   a
            |||||  |||||||||  ||||||||||| |    
3'          ugugc  auuuucugu  ccguuacucua u   u
   ----uuuau     aa         aa           c aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1403: 125898-125981 [+]
intergenic
Contig5146: 10700-10783 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-71a-1
sme-mir-71a-1Contig1403: 125898-125981 [+]
sme-mir-2a-1Contig1403: 125998-126087 [+]
Database links

Mature sequence sme-miR-71a-5p

Accession MIMAT0003984
Previous IDssme-miR-71a
Sequence

17 - 

ugaaagacacggguagugagau

 - 38

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-71a-1-3p

Accession MIMAT0012106
Previous IDssme-miR-71a-1*
Sequence

52 - 

ucucauugccaaugucuuuuaa

 - 73

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).