Stem-loop sequence sme-mir-61a

AccessionMI0005148 (change log)
Previous IDssme-mir-61
DescriptionSchmidtea mediterranea miR-61a stem-loop
Stem-loop
   uuuuua   --ua       uugau     uu     -       gca      u 
5'       gaa    gaaacuc     acagu  gugag uuucuag   uauaga u
         |||    |||||||     |||||  ||||| |||||||   ||||||  
3'       cuu    uuuugag     uguca  cacuu aaagauc   guaucu u
   ---uua   caaa       caugu     uu     g       --a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig315: 54913-55016 [+]
intergenic
Database links

Mature sequence sme-miR-61a-5p

Accession MIMAT0012105
Previous IDssme-miR-61a*
Sequence

25 - 

caguuugugaguuucuaggcau

 - 46

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-61a-3p

Accession MIMAT0003983
Previous IDssme-miR-61;sme-miR-61a
Sequence

60 - 

ugacuagaaaguucacuuacugu

 - 82

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).