Stem-loop sequence sme-mir-36a

AccessionMI0005147 (change log)
Previous IDssme-mir-36
DescriptionSchmidtea mediterranea miR-36a stem-loop
Stem-loop
      c     guuu     c   -         uu     uua 
5' agc acagu    ugaug aug cuacuuggu  uguug   u
   ||| |||||    ||||| ||| |||||||||  |||||   u
3' uug uguca    auuac uac gaugggcca  acaau   a
      u     acau     u   a         cu     uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3934: 37835-37920 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-36a
sme-mir-36cContig3934: 37302-37403 [+]
sme-mir-36aContig3934: 37835-37920 [+]
Database links

Mature sequence sme-miR-36a-5p

Accession MIMAT0003981
Previous IDssme-miR-36*;sme-miR-36a*
Sequence

14 - 

ugaugcaugcuacuugguuu

 - 33

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-36a-3p

Accession MIMAT0003982
Previous IDssme-miR-36;sme-miR-36a
Sequence

53 - 

ucaccggguagacauucauua

 - 73

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).