|
miRBase |
|
Stem-loop sequence sme-mir-36a |
||||||
| Accession | MI0005147 | |||||
| Previous IDs | sme-mir-36 | |||||
| Description | Schmidtea mediterranea miR-36a stem-loop | |||||
| Stem-loop |
c guuu c - uu uua agc acagu ugaug aug cuacuuggu uguug u ||| ||||| ||||| ||| ||||||||| ||||| u uug uguca auuac uac gaugggcca acaau a u acau u a cu uau |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence sme-miR-36a-5p |
|
| Accession | MIMAT0003981 |
| Previous IDs | sme-miR-36*;sme-miR-36a* |
| Sequence |
14 - ugaugcaugcuacuugguuu - 33 |
| Evidence | experimental; cloned [1], 454 [2], Solexa [2-3] |
Mature sequence sme-miR-36a-3p |
|
| Accession | MIMAT0003982 |
| Previous IDs | sme-miR-36;sme-miR-36a |
| Sequence |
53 - ucaccggguagacauucauua - 73 |
| Evidence | experimental; cloned [1], 454 [2], Solexa [2-3] |
References |
|
| 1 |
PMID:16849698
"MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology"
RNA. 12:1640-1649(2006).
|
| 2 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
| 3 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|