Stem-loop sequence sme-mir-31b-1

AccessionMI0005146 (change log)
Previous IDssme-mir-31b
DescriptionSchmidtea mediterranea miR-31b-1 stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention sme-mir-31b-1
(1 sentences)

Stem-loop
          auga  a  c     g    c       a   acu 
5' auugaua    ca gg aagau cugg auagcug uaa   a
   |||||||    || || ||||| |||| ||||||| |||    
3' uaacuau    gu cc uucua gacu uaucgac auu   u
          auaa  c  u     g    -       c   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig5733: 42326-42410 [+]
intergenic
Database links

Mature sequence sme-miR-31b-5p

Accession MIMAT0003980
Previous IDssme-miR-31b
Sequence

14 - 

aggcaagaugcuggcauagcuga

 - 36

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-31b-1-3p

Accession MIMAT0011413
Previous IDssme-miR-31b-1*
Sequence

52 - 

cagcuauucaggaucuuucccu

 - 73

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).