Stem-loop sequence sme-mir-31a

AccessionMI0005145 (change log)
DescriptionSchmidtea mediterranea miR-31a stem-loop
Literature search

1 open access papers mention sme-mir-31a
(1 sentences)

Stem-loop
   uuuua     a    uuaa  c   a       a       caac     g 
5'      uuguu uguu    gg aag uguuggc uaacuga    aauuc a
        ||||| ||||    || ||| ||||||| |||||||    |||||  
3'      aacaa acga    cc uuc acgauug auugacu    uuagg a
   ----a     a    uaga  a   -       c       uuaa     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig18208: 1122-1220 [-]
intergenic
Database links

Mature sequence sme-miR-31a-5p

Accession MIMAT0003979
Previous IDssme-miR-31a
Sequence

19 - 

aggcaagauguuggcauaacuga

 - 41

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-31a-3p

Accession MIMAT0012104
Previous IDssme-miR-31a*
Sequence

65 - 

caguuacguuagcacuuacca

 - 85

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).