Stem-loop sequence sme-mir-13

AccessionMI0005142 (change log)
DescriptionSchmidtea mediterranea miR-13 stem-loop
Stem-loop
       -       --            -   a 
5' gagc cuuuggc  ggcugugauaug aua u
   |||| |||||||  |||||||||||| |||  
3' uucg gaaaucg  cugacacuauac uau u
       a       ua            a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1374: 32236-32295 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-13
sme-mir-71bContig1374: 32561-32660 [-]
sme-mir-2dContig1374: 32443-32550 [-]
sme-mir-752Contig1374: 32325-32438 [-]
sme-mir-13Contig1374: 32236-32295 [-]
Database links

Mature sequence sme-miR-13-5p

Accession MIMAT0012101
Previous IDssme-miR-13*
Sequence

1 - 

gagccuuuggcggcugugauau

 - 22

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence sme-miR-13-3p

Accession MIMAT0003976
Previous IDssme-miR-13
Sequence

37 - 

uaucacagucaugcuaaagagc

 - 58

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).