Stem-loop sequence sme-mir-12

AccessionMI0005141 (change log)
DescriptionSchmidtea mediterranea miR-12 stem-loop
Literature search

1 open access papers mention sme-mir-12
(2 sentences)

Stem-loop
   auuuu    auc   c c      uu          u    aaau      ag 
5'      aucc   gcu a ugagua  cuaucaggag cgaa    gcguua  u
        ||||   ||| | ||||||  |||||||||| ||||    ||||||  u
3'      uagg   cga u auucau  gguaguucuc gcuu    ugcaau  a
   -uuuu    aaa   a a      uu          u    ----      ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig14699: 8967-9070 [-]
intergenic
Database links

Mature sequence sme-miR-12-5p

Accession MIMAT0003975
Previous IDssme-miR-12
Sequence

19 - 

ugaguauucuaucaggagucga

 - 40

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-12-3p

Accession MIMAT0012100
Previous IDssme-miR-12*
Sequence

67 - 

cgucucuugaugguuuacuuaau

 - 89

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).