Stem-loop sequence sme-mir-10b

AccessionMI0005140 (change log)
Previous IDssme-mir-10
DescriptionSchmidtea mediterranea miR-10b stem-loop
Literature search

1 open access papers mention sme-mir-10b
(1 sentences)

Stem-loop
            au  ga   c  u    c   g       --     --   ugu 
5' cugucaccg  cu  acc ug agau cga uuugauu  aaugc  caa   u
   |||||||||  ||  ||| || |||| ||| |||||||  |||||  |||   g
3' gauaguggu  ga  ugg ac ucua gcu aaacuaa  uuacg  guu   a
            -c  ag   a  u    a   a       cu     aa   uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig24755: 3773-3876 [-]
intergenic
Database links

Mature sequence sme-miR-10b-5p

Accession MIMAT0003973
Previous IDssme-miR-10;sme-miR-10b
Sequence

15 - 

aacccuguagauccgaguuuga

 - 36

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-10b-3p

Accession MIMAT0003974
Previous IDssme-miR-10*;sme-miR-10b*
Sequence

76 - 

ucgaaucuucaaggugaa

 - 93

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).