Stem-loop sequence sme-mir-7c

AccessionMI0005138 (change log)
DescriptionSchmidtea mediterranea miR-7c stem-loop
Literature search

1 open access papers mention sme-mir-7c
(1 sentences)

Stem-loop
   u  a   guuu     uu  u      cu  u         aac  a 
5'  ga uaa    aauau  ug ggaaga  ga gauuugcug   gc u
    || |||    |||||  || ||||||  || |||||||||   || g
3'  cu auu    uuaua  ac ucuucu  cu cugggcgac   cg c
   a  a   -auu     uu  -      uu  u         ---  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig14269: 19335-19426 [+]
intergenic
Database links

Mature sequence sme-miR-7c-5p

Accession MIMAT0003971
Previous IDssme-miR-7c
Sequence

21 - 

uggaagacugaugauuugcuga

 - 42

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-7c-3p

Accession MIMAT0012098
Previous IDssme-miR-7c*
Sequence

54 - 

cagcgggucuucuuucuucuca

 - 75

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).