Stem-loop sequence sme-mir-7a

AccessionMI0005136 (change log)
DescriptionSchmidtea mediterranea miR-7a stem-loop
Literature search

1 open access papers mention sme-mir-7a
(1 sentences)

Stem-loop
        uuu   a     uu  u         uu   ua 
5' cauaa   gga gacua  ga uuaguugaa  ggu  a
   |||||   ||| |||||  || |||||||||  |||   
3' guauu   ccu cugau  cu agucaacuu  uca  u
        ---   a     --  u         --   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig4049: 1281-1351 [+]
intergenic
Database links

Mature sequence sme-miR-7a-5p

Accession MIMAT0003969
Previous IDssme-miR-7a
Sequence

8 - 

uggaagacuauugauuuaguuga

 - 30

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-7a-3p

Accession MIMAT0012096
Sequence

47 - 

ucaacugauucuagucauccuua

 - 69

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).