Stem-loop sequence sme-mir-2d

AccessionMI0005135 (change log)
DescriptionSchmidtea mediterranea miR-2d stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
        auuu     --c   c        uu     a    c    ga   ug uaac 
5' gugac    ugccu   uua ggacauca  auuug cugu gaua  uau  g    a
   |||||    |||||   ||| ||||||||  ||||| |||| ||||  |||  |     
3' cacug    augga   aau ccuguagu  uaaac gaca cuau  aug  u    u
        ----     aua   -        -u     c    -    -g   gu uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1374: 32443-32550 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2d
sme-mir-71bContig1374: 32561-32660 [-]
sme-mir-2dContig1374: 32443-32550 [-]
sme-mir-752Contig1374: 32325-32438 [-]
sme-mir-13Contig1374: 32236-32295 [-]
Database links

Mature sequence sme-miR-2d-5p

Accession MIMAT0012095
Sequence

21 - 

gacaucauuauuugacugucgau

 - 43

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence sme-miR-2d-3p

Accession MIMAT0003968
Previous IDssme-miR-2d
Sequence

72 - 

ucacagccaaauuugaugucc

 - 92

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).