Stem-loop sequence sme-mir-2a-1

Accession MI0005131
Description Schmidtea mediterranea miR-2a-1 stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       u  guga      -   -u   a         uuucua 
guucauu au    guucca gug  gcu ugauguaua      a
||||||| ||    |||||| |||  ||| |||||||||       
uaaguaa ua    caaggu cgc  cga acuauauau      a
       u  aucg      u   cc   c         cuuuaa 
Get sequence
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1403: 125998-126087 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2a-1
sme-mir-71a-1 Contig1403: 125898-125981 [+]
sme-mir-2a-1 Contig1403: 125998-126087 [+]

Mature sequence sme-miR-2a-1-5p

Accession MIMAT0003964
Previous IDs sme-miR-2a*;sme-miR-2a-1*
Sequence

14 - 

aguuccagugugcuaugaugua

 - 35

Get sequence
Evidence experimental; 454 [2], Solexa [2-3]

Mature sequence sme-miR-2a-3p

Accession MIMAT0003963
Previous IDs sme-miR-2a
Sequence

56 - 

uaucacagccccgcuuggaacgcu

 - 79

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Solexa [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).