Stem-loop sequence sme-let-7a

AccessionMI0005122 (change log)
DescriptionSchmidtea mediterranea let-7a stem-loop
Literature search

2 open access papers mention sme-let-7a
(9 sentences)

Stem-loop
           cau         u       ga  aa    aag 
5' aucaaauu   gagguagaa guuggau  cu  ggua   g
   ||||||||   ||||||||| |||||||  ||  ||||   u
3' uaguuuaa   uuccgucuu uaacuug  ga  cuau   a
           aau         u       uc  ga    aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sme-let-7a-5p

Accession MIMAT0003952
Previous IDssme-let-7a
Sequence

11 - 

ugagguagaauguuggaugacu

 - 32

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-let-7a-3p

Accession MIMAT0012087
Previous IDssme-let-7a*
Sequence

55 - 

gcuguucaauuuucugccuuuaa

 - 77

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).