Stem-loop sequence sme-bantam-b

AccessionMI0005120 (change log)
DescriptionSchmidtea mediterranea bantam-b stem-loop
Gene family MIPF0000153; bantam
Literature search

2 open access papers mention sme-bantam-b
(2 sentences)

Stem-loop
   --------     aaaac          u a          au 
5'         cuuua     cgguuuucgu g gaucuuagau  a
           |||||     |||||||||| | ||||||||||   
3'         gaagu     gucgaaagcg c cuagagucua  u
   cuuucgcu     -auua          u a          cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig362: 106656-106734 [-]
intergenic
Database links

Mature sequence sme-bantam-b-5p

Accession MIMAT0012085
Previous IDssme-bantam-b*
Sequence

10 - 

ccgguuuucguugagaucuua

 - 30

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-bantam-b-3p

Accession MIMAT0003950
Previous IDssme-bantam-b
Sequence

43 - 

ugagaucacugcgaaagcugau

 - 64

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).