Stem-loop sequence ptc-MIR171k

AccessionMI0005114 (change log)
DescriptionPopulus trichocarpa miR171k stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ptc-MIR171k
(11 sentences)

Stem-loop
       c    u        c  c       uc    uga 
5' gaua uggc cgguucaa cu aucguag  uuga   a
   |||| |||| |||||||| || |||||||  ||||    
3' cuau accg gccgaguu gg ugguauc  aacu   u
       a    c        a  u       ua    uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homolog of a verified miRNA in Arabidopsis (E. Bonnet, pers. comm.).

Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 5060947-5061024 [-]
intergenic
Database links

Mature sequence ptc-miR171k

Accession MIMAT0003943
Sequence

58 - 

ggauugagccgcgccaauauc

 - 78

Get sequence
Evidence by similarity; MI0000989