Stem-loop sequence ath-MIR781a

AccessionMI0005111 (change log)
Previous IDsath-MIR781
DescriptionArabidopsis thaliana miR781 stem-loop
Gene family MIPF0001137; MIR781
Literature search

3 open access papers mention ath-MIR781a
(6 sentences)

Stem-loop
          -                   uu     c  a a     a 
5' ucaaauu agaguuuucuggauacuua  aguua ua c aagag g
   ||||||| |||||||||||||||||||  ||||| || | ||||| g
3' aguuuaa ucucaaaagaccuaugaau  ucaau au g uucuu g
          a                   uu     u  a c     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 7423518-7423611 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR781a
ath-MIR781achr1: 7423518-7423611 [+]
ath-MIR781bchr1: 7423521-7423607 [-]
Database links

Mature sequence ath-miR781a

Accession MIMAT0003940
Previous IDsath-miR781
Sequence

6 - 

uuagaguuuucuggauacuua

 - 26

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).