Stem-loop sequence ath-MIR780

Accession MI0005110
Description Arabidopsis thaliana miR780 stem-loop
Stem-loop 
      au        u        u      a        a ------     ----a          u   guuucacaaacaucaacag 
caagau  cagauauu cacgaaga aucugc uaacagcu c      gagga     auugugauuu auc                   c
||||||  |||||||| |||||||| |||||| |||||||| |      |||||     |||||||||| |||                    
guuuua  gucuauaa gugcuucu uggacg guugucga g      uuccu     uaacacuaaa uag                   u
      cg        -        u      a        c aucuuu     aucac          -   gcagguauugcuagguacc
Get sequence
Deep sequencing
927 reads, 5 experiments
Comments

Fahlgren et al [2] identify two mature products from the same arm of the hairpin precursor, named here miR780.1 and miR780.2. miR780.2 corresponds to the sequence reported by Lu et al [1].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr4: 8504141-8504314 [-]
intergenic

Mature sequence ath-miR780.1

Accession MIMAT0004218
Sequence

129 -  

ucuagcagcuguugagcaggu

 - 149

Get sequence
Deep sequencing 252 reads, 5 experiments
Evidence experimental; 454 [2], cloned [2], Solexa [3]

Mature sequence ath-miR780.2

Accession MIMAT0003939
Previous IDs ath-miR780
Sequence

150 -  

uucuucgugaauaucuggcau

 - 170

Get sequence
Deep sequencing 225 reads, 4 experiments
Evidence experimental; MPSS [1], Northern [1], 454 [2], cloned [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).