Stem-loop sequence ath-MIR779

AccessionMI0005109 (change log)
DescriptionArabidopsis thaliana miR779 stem-loop
Literature search

2 open access papers mention ath-MIR779
(13 sentences)

Stem-loop
         -           u     u    a    uuucaa  a      u   c     c               u          
5' aaugag aguaauauagu gaauc ucga agua      ga gucagc gag uuucu gucaucacuuauuag aaauauagu 
   |||||| ||||||||||| ||||| |||| ||||      || |||||| ||| ||||| ||||||||||||||| |||||||| c
3' uuacuc ucguuguaucg cuuag aguu ucau      cu caguug cuu aaagg uaguagugaguaguu uuuauaucu 
         g           u     u    c    ----ua  -      -   u     u               -          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 9560761-9560923 [+]
intergenic
Database links

Mature sequence ath-miR779.2

Accession MIMAT0004329
Sequence

106 - 

ugauuggaaauuucguugacu

 - 126

Get sequence
Evidence experimental; 454 [3]

Mature sequence ath-miR779.1

Accession MIMAT0003938
Previous IDsath-miR779
Sequence

142 - 

uucugcuauguugcugcucau

 - 162

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2-3], cloned [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).