Stem-loop sequence ath-MIR778

AccessionMI0005108 (change log)
DescriptionArabidopsis thaliana miR778 stem-loop
Literature search

3 open access papers mention ath-MIR778
(11 sentences)

Stem-loop
   -         c                    a       cuccauccuauacagauuuugggacaugu 
5'  ccgccuugg uugguuuauguacaccgagu uguucag                             g
    ||||||||| |||||||||||||||||||| |||||||                             c
3'  ggcggaacc aaccagauacauguggcuca acaaguc                             c
   u         a                    a       aagaaagauauauacuuuggaguugggau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 17349437-17349574 [-]
intergenic
Database links

Mature sequence ath-miR778

Accession MIMAT0003937
Sequence

7 - 

uggcuugguuuauguacaccg

 - 27

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).