Stem-loop sequence ath-MIR777

AccessionMI0005107 (change log)
DescriptionArabidopsis thaliana miR777 stem-loop
Stem-loop
             -   a            u       -c      uuau    gu   c 
5' agagagcaac aaa ucaguguguauu guuaaga  aaaugu    auaa  cgu c
   |||||||||| ||| |||||||||||| |||||||  ||||||    ||||  |||  
3' ucuuucguug uuu aguuacgcauaa caauucu  uuuaca    uguu  gcg a
             c   g            u       aa      ----    --   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 26638000-26638107 [+]
intergenic
Database links

Mature sequence ath-miR777

Accession MIMAT0003936
Sequence

84 - 

uacgcauugaguuucguugcuu

 - 105

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2-3], cloned [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).