|
miRBase |
|
Stem-loop sequence ath-MIR776 |
|||||
| Accession | MI0005106 | ||||
| Description | Arabidopsis thaliana miR776 stem-loop | ||||
| Stem-loop |
ug a u c - uu ag a u - u aa u gg uua agcca gaac ucaauagaa cuua auc ug gaaaa cgu gac g | || ||| ||||| |||| ||||||||| |||| ||| || ||||| ||| ||| a cc aau ucggu cuug aguuaucuu gaau uag ac cuuuu gca cug a gu - u a u cu cu a - a u cu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence ath-miR776 |
|
| Accession | MIMAT0003935 |
| Sequence |
82 - ucuaagucuucuauugauguu - 102 |
| Deep sequencing | 12 reads, 3 experiments |
| Evidence | experimental; MPSS [1], Northern [1], 454 [2], cloned [2] |
References |
|
| 1 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
| 2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|