Stem-loop sequence ath-MIR776

AccessionMI0005106 (change log)
DescriptionArabidopsis thaliana miR776 stem-loop
Stem-loop
    ug  a   u     c    -         uu    ag   a  u     -   u   aa 
5' u  gg uua agcca gaac ucaauagaa  cuua  auc ug gaaaa cgu gac  g
   |  || ||| ||||| |||| |||||||||  ||||  ||| || ||||| ||| |||   
3' a  cc aau ucggu cuug aguuaucuu  gaau  uag ac cuuuu gca cug  a
    gu  -   u     a    u         cu    cu   a  -     a   u   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22795618-22795735 [+]
intergenic
Database links

Mature sequence ath-miR776

Accession MIMAT0003935
Sequence

82 - 

ucuaagucuucuauugauguu

 - 102

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2], cloned [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).