Stem-loop sequence ath-MIR775

AccessionMI0005105 (change log)
DescriptionArabidopsis thaliana miR775 stem-loop
Literature search

7 open access papers mention ath-MIR775
(40 sentences)

Stem-loop
   u          -    acgu          c       c    uu    -    ucaacuu 
5'  uuaaacguug cacu    gacauugaaa ugucuuu aaca  ccaa uauu       u
    |||||||||| ||||    |||||||||| ||||||| ||||  |||| ||||       c
3'  aauuuguaac guga    cuguagcuuu acagaaa uugu  gguu auaa       g
   a          c    cgau          u       c    uu    u    cccauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 29422452-29422574 [+]
intergenic
Database links

Mature sequence ath-miR775

Accession MIMAT0003934
Sequence

95 - 

uucgaugucuagcagugcca

 - 114

Get sequence
Evidence experimental; MPSS [1], Northern [1,3], 454 [2-3], cloned [2], Illumina [4]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).