Stem-loop sequence ath-MIR774a

AccessionMI0005104 (change log)
Previous IDsath-MIR774
DescriptionArabidopsis thaliana miR774 stem-loop
Gene family MIPF0001101; MIR774
Literature search

2 open access papers mention ath-MIR774a
(9 sentences)

Stem-loop
   uc    c          u              u    auu     c   u 
5'   auuu agauggcugu uggguaacuaauau uaag   uuggu aau u
     |||| |||||||||| |||||||||||||| ||||   ||||| |||  
3'   uaaa ucuaccggua acccauugguuaua auuu   aacca uug a
   uu    c          u              u    ---     -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22149936-22150033 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR774a
ath-MIR859chr1: 22149718-22149843 [+]
ath-MIR774achr1: 22149936-22150033 [+]
ath-MIR774bchr1: 22150128-22150266 [+]
Database links

Mature sequence ath-miR774a

Accession MIMAT0003933
Previous IDsath-miR774
Sequence

70 - 

uugguuacccauauggccauc

 - 90

Get sequence
Evidence experimental; MPSS [1], Northern [1], 454 [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).