Stem-loop sequence ath-MIR771

AccessionMI0005101 (change log)
DescriptionArabidopsis thaliana miR771 stem-loop
Gene family MIPF0001122; MIR771
Stem-loop
   --uaa     u       c    u  u        caaugaucucaauagagugcau 
5'      auucg caugagc ucug gg agcccuca                      g
        ||||| ||||||| |||| || ||||||||                       
3'      uaagc guacuug ggac cc ucgggagu                      c
   gauug     u       u    u  -        agaugcagaaauguucuagcac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 19659301-19659413 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR771
ath-MIR851chr3: 19659532-19659715 [-]
ath-MIR771chr3: 19659301-19659413 [-]
Database links

Mature sequence ath-miR771

Accession MIMAT0003930
Sequence

12 - 

ugagccucugugguagcccuca

 - 33

Get sequence
Evidence experimental; MPSS [1], Northern [1,3], 454 [2-3], cloned [2]

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).