|
miRBase |
|
Stem-loop sequence mdv1-mir-M2 |
||||||||||||||||||||||||||||||||||||||
| Accession | MI0005094 | |||||||||||||||||||||||||||||||||||||
| Previous IDs | mdv-mir-M2 | |||||||||||||||||||||||||||||||||||||
| Description | Mareks disease virus miR-M2 stem-loop | |||||||||||||||||||||||||||||||||||||
| Stem-loop |
aa ug cc g g aagaaagu uauucugc gguaguccguuu uaa g |||||||| |||||||| |||||||||||| ||| uucuuucg auaagacg ccgucaggcaag guu u -g -- -- - c |
|||||||||||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Mature sequence mdv1-miR-M2-5p |
|
| Accession | MIMAT0003921 |
| Previous IDs | mdv-miR-M2;mdv1-miR-M2 |
| Sequence |
9 - guuguauucugcccgguaguccg - 31 |
| Evidence | experimental; cloned [1-3], Northern [1-2], Solexa [4] |
Mature sequence mdv1-miR-M2-3p |
|
| Accession | MIMAT0003922 |
| Previous IDs | mdv-miR-M2*;mdv1-miR-M2* |
| Sequence |
49 - cggacugccgcagaauagcuu - 69 |
| Evidence | experimental; cloned [1-3], Northern [1-2], Solexa [4] |
References |
|
| 1 |
PMID:16912324
"Marek's disease virus encodes MicroRNAs that map to meq and the latency-associated transcript"
J Virol. 80:8778-8786(2006).
|
| 2 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
| 3 |
PMID:18430245
"Deep sequencing of chicken microRNAs"
BMC Genomics. 9:185(2008).
|
| 4 |
PMID:18842708
"Sequence conservation and differential expression of Marek's disease virus microRNAs"
J Virol. 82:12213-12220(2008).
|