|
miRBase |
|
Stem-loop sequence mdv1-mir-M1 |
||||||||||||||||||||||||||||||||||||||
| Accession | MI0005093 | |||||||||||||||||||||||||||||||||||||
| Previous IDs | mdv-mir-M1 | |||||||||||||||||||||||||||||||||||||
| Description | Mareks disease virus miR-M1 stem-loop | |||||||||||||||||||||||||||||||||||||
| Stem-loop |
uucc u g c acau cc uuugcuu uuca ugugcggcauuauu u || ||||||| |||| |||||||||||||| u gg aagcgag aagu acgcgucguaaugg a --aa c a - ccac |
|||||||||||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||
Mature sequence mdv1-miR-M1-5p |
|
| Accession | MIMAT0003920 |
| Previous IDs | mdv-miR-M1;mdv1-miR-M1 |
| Sequence |
10 - ugcuuguucacugugcggca - 29 |
| Evidence | experimental; cloned [1-3], Northern [1], Solexa [4] |
Mature sequence mdv1-miR-M1-3p |
|
| Accession | MIMAT0005801 |
| Previous IDs | mdv1-miR-M1* |
| Sequence |
51 - ugcugcgcaugaaagagcga - 70 |
| Evidence | experimental; cloned [2], Northern [2], Solexa [4] |
References |
|
| 1 |
PMID:16912324
"Marek's disease virus encodes MicroRNAs that map to meq and the latency-associated transcript"
J Virol. 80:8778-8786(2006).
|
| 2 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
| 3 |
PMID:18430245
"Deep sequencing of chicken microRNAs"
BMC Genomics. 9:185(2008).
|
| 4 |
PMID:18842708
"Sequence conservation and differential expression of Marek's disease virus microRNAs"
J Virol. 82:12213-12220(2008).
|