Stem-loop sequence osa-MIR395r

AccessionMI0005092 (change log)
DescriptionOryza sativa miR395r stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395r
(166 sentences)

Stem-loop
            u   c          ----  ca     
5' gaguucccu caa cacuucacgu    gg  cuau 
   ||||||||| ||| ||||||||||    ||  ||| u
3' cucaagggg guu gugaagugua    cc  gauu 
            -   u          ucau  ag     
Get sequence
Deep sequencing
32 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1].

Database links

Mature sequence osa-miR395r

Accession MIMAT0003878
Sequence

48 - 

gugaaguguuugggggaacuc

 - 68

Get sequence
Deep sequencing27 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).