Stem-loop sequence osa-MIR395w

AccessionMI0005091 (change log)
DescriptionOryza sativa miR395w stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395w
(167 sentences)

Stem-loop
   --         uuaau          ----   a  au 
5'   gaguucucu     cauuucacau    ggc cu  u
     |||||||||     ||||||||||    ||| ||   
3'   cuuaggggg     gugaagugug    ccg ga  u
   cu         --uuu          ucau   -  au 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 6606291-6606359 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395w
osa-MIR395tChr9: 6607353-6607495 [-]
osa-MIR395uChr9: 6606701-6606786 [-]
osa-MIR395vChr9: 6606575-6606643 [-]
osa-MIR395wChr9: 6606291-6606359 [-]
Database links

Mature sequence osa-miR395w

Accession MIMAT0003877
Sequence

48 - 

gugaaguguuugggggauucuc

 - 69

Get sequence
Deep sequencing23 reads, 2 experiments
Evidence experimental; cloned [2]

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).
2
PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).