Stem-loop sequence osa-MIR395q

AccessionMI0005088 (change log)
DescriptionOryza sativa miR395q stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395q
(166 sentences)

Stem-loop
            u              ----    cua 
5' gaguucccu caagcacuucacau    gaca   u
   ||||||||| ||||||||||||||    ||||   u
3' cucaagggg guuugugaagugua    cugu   u
            -              uuau    aac 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 32622668-32622735 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395q
osa-MIR395mChr4: 32621993-32622112 [+]
osa-MIR395nChr4: 32622243-32622308 [+]
osa-MIR395oChr4: 32622381-32622449 [+]
osa-MIR395pChr4: 32622525-32622592 [+]
osa-MIR395qChr4: 32622668-32622735 [+]
osa-MIR395rChr4: 32622811-32622878 [+]
osa-MIR395sChr4: 32622943-32623028 [+]
osa-MIR395xChr4: 32623067-32623162 [+]
Database links

Mature sequence osa-miR395q

Accession MIMAT0003874
Sequence

48 - 

gugaaguguuugggggaacuc

 - 68

Get sequence
Deep sequencing27 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).