Stem-loop sequence mtr-MIR395k

AccessionMI0005083 (change log)
DescriptionMedicago truncatula miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395k
(12 sentences)

Stem-loop
                 a     u     acucaauuu 
5' gaguucccuuaaac uuuca uaagg         c
   |||||||||||||| ||||| |||||          
3' cucaaggggguuug gaagu guucc         u
                 c     u     aacuucucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR395k

Accession MIMAT0003869
Sequence

52 - 

uugaagcguuugggggaacuc

 - 72

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).