Stem-loop sequence mtr-MIR395o

AccessionMI0005082 (change log)
DescriptionMedicago truncatula miR395o stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395o
(12 sentences)

Stem-loop
            ug   u       uaaagggcuauagcaaga 
5' gaguuccuc  aac cuucauc                  a
   |||||||||  ||| |||||||                  a
3' cucaagggg  uug gaaguag                  g
            gu   u       uauguuccuaaaaggaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16556404-16556486 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395o
mtr-MIR395ochr5: 16556404-16556486 [-]
mtr-MIR2665chr5: 16554970-16555082 [-]
mtr-MIR395kchr5: 16553926-16553997 [+]
Database links

Mature sequence mtr-miR395o

Accession MIMAT0003868
Sequence

63 - 

augaaguguuugggggaacuc

 - 83

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).