Stem-loop sequence mtr-MIR395n

AccessionMI0005081 (change log)
DescriptionMedicago truncatula miR395n stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395n
(12 sentences)

Stem-loop
            ug          gcau      au      ----auu   u u 
5' gaguuccuu  aacgcuucau    gagaau  cuaucu       ugg c a
   |||||||||  ||||||||||    ||||||  ||||||       ||| |  
3' cucaagggg  uugugaagua    uuuuua  gauaga       acc g a
            gu          -acu      cc      aaagauu   u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16591743-16591843 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395n
mtr-MIR395fchr5: 16598925-16599022 [-]
mtr-MIR395nchr5: 16591743-16591843 [-]
Database links

Mature sequence mtr-miR395n

Accession MIMAT0003867
Sequence

81 - 

augaaguguuugggggaacuc

 - 101

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).