Stem-loop sequence mtr-MIR395j

AccessionMI0005077 (change log)
DescriptionMedicago truncatula miR395j stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395j
(12 sentences)

Stem-loop
            ug         ---    u   a a    a 
5' gaguuccuc  aaugcuuca   aaca gag c aucu u
   |||||||||  |||||||||   |||| ||| | ||||  
3' cucaagggg  uugugaagu   uugu cuu g uagg a
            gu         aac    u   - a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16671143-16671218 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395j
mtr-MIR395jchr5: 16671143-16671218 [-]
mtr-MIR2671cchr5: 16668115-16668473 [-]
Database links

Mature sequence mtr-miR395j

Accession MIMAT0003863
Sequence

56 - 

augaaguguuugggggaacuc

 - 76

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).