Stem-loop sequence mtr-MIR395i

AccessionMI0005076 (change log)
DescriptionMedicago truncatula miR395i stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395i
(12 sentences)

Stem-loop
            ug         -auc ug   caau    a 
5' gaguuccuc  aaugcuuca    a  aga    cuau u
   |||||||||  |||||||||    |  |||    ||||  
3' cucaagggg  uugugaagu    u  ucu    gaua g
            gu         aacu gu   ---u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16656267-16656342 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395i
mtr-MIR395ichr5: 16656267-16656342 [-]
mtr-MIR395bchr5: 16653454-16653577 [-]
Database links

Mature sequence mtr-miR395i

Accession MIMAT0003862
Sequence

56 - 

augaaguguuugggggaacuc

 - 76

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).