Stem-loop sequence mtr-MIR395f

AccessionMI0005073 (change log)
DescriptionMedicago truncatula miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395f
(12 sentences)

Stem-loop
            ug           cau     --a    ---   -u   uuu 
5' gaguuccuu  aacgcuucaug   gagaa   uauc   ucu  ugg   a
   |||||||||  |||||||||||   |||||   ||||   |||  |||    
3' cucaagggg  uugugaaguau   cuuuu   auag   aga  acc   a
            gu           cuu     aug    aaa   uu   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16598925-16599022 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395f
mtr-MIR395echr5: 16605860-16605959 [-]
mtr-MIR395fchr5: 16598925-16599022 [-]
mtr-MIR395nchr5: 16591743-16591843 [-]
Database links

Mature sequence mtr-miR395f

Accession MIMAT0003859
Sequence

78 - 

augaaguguuugggggaacuc

 - 98

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).