Stem-loop sequence mtr-MIR395e

AccessionMI0005072 (change log)
DescriptionMedicago truncatula miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395e
(12 sentences)

Stem-loop
            ug          -gcau      -        auu   uuu 
5' gaguuccuu  aacgcuucau     gagaau aucuaucu   ugg   a
   |||||||||  ||||||||||     |||||| ||||||||   |||    
3' cucaagggg  uugugaagua     uucuug uagauagg   acc   a
            gu          aauuc      a        auu   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16605860-16605959 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395e
mtr-MIR395achr5: 16610555-16610689 [-]
mtr-MIR395echr5: 16605860-16605959 [-]
mtr-MIR395fchr5: 16598925-16599022 [-]
Database links

Mature sequence mtr-miR395e

Accession MIMAT0003858
Sequence

80 - 

augaaguguuugggggaacuc

 - 100

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).