Stem-loop sequence mtr-MIR395d

AccessionMI0005071 (change log)
DescriptionMedicago truncatula miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395d
(12 sentences)

Stem-loop
            ug          gca      uau      gg     aa 
5' gaguuccuu  aacgcuucau   ugagaa   cuauuu  ucuaa  u
   |||||||||  ||||||||||   ||||||   ||||||  |||||   
3' cucaagggg  uugugaagua   auucuu   gauaaa  agauu  c
            gu          --a      cuu      -a     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16616400-16616494 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395d
mtr-MIR395cchr5: 16622264-16622360 [-]
mtr-MIR395dchr5: 16616400-16616494 [-]
mtr-MIR395achr5: 16610555-16610689 [-]
Database links

Mature sequence mtr-miR395d

Accession MIMAT0003857
Sequence

75 - 

augaaguguuugggggaacuc

 - 95

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).